Enzymy pro in vitro transkripci

Informujte se o vlastnostech, přednostech a možnostech aplikací enzymů pro in vitro transkripci. Enzymy, které by nejlépe vyhovovaly vašim potřebám a projektům můžete zakoupit v našem eshopu BIOGEN.


SP6 RNA polymeráza

Thermo Scientific bakteriofágní SP6 RNA polymeráza je DNA - dependentní RNA polymeráza s vysokou specifitou pro svůj dvouřetězcový promotor. Enzym katalyzuje 5' → 3' syntézu RNA buď na jednovláknové, nebo dvouvláknové DNA ve směru syntézy od svého promotoru a je schopen zařadit do RNA modifikované nukleotidy.

Přednosti

  • Inkorporuje modifikované nukleotidy (například aminoallyl-, biotin-, fluorescein-, digoxigenin- značené nukleotidy)

Aplikace

  • Syntéza neznačené a značené RNA, která může být použita:
    • pro hybridizaci, in vitro RNA translaci;
    • jako aRNA, siRNA, substrát při ochraně před RNázami, templát při sekvenování genomové DNA;
    • ve studiích sekundární struktury RNA, RNA-proteinových interakcí a RNA sestřihu.

Konsensus sekvence promotoru:

SP6 ATTTAGGTGACACTATAGAAGNG
Podtržená pozice (+1) představuje první nukleotid inkorporovaný do RNA během transkripce. Pouze báze v této pozici a až do +3 jsou kritické pro transkripci a musí to být G respektive purinová báze.


T3 RNA polymeráza

Thermo Scientific bakteriofágní T3 RNA polymeráza je DNA - dependentní RNA polymeráza s vysokou specifitou pro svůj dvouřetězcový promotor. Enzym katalyzuje 5' => 3' syntézu RNA buď na jednovláknové, nebo dvouvláknové DNA ve směru syntézy od svého promotoru.

Přednosti

  • Inkorporuje modifikované nukleotidy (například aminoallyl-, biotin-, fluorescein-, digoxigenin- značené nukleotidy)

Aplikace

  • Syntéza neznačené a značené RNA, která může být použita:
    • pro hybridizaci, in vitro RNA translaci;
    • jako aRNA, siRNA, substrát při ochraně před RNázami, templát při sekvenování genomové DNA;
    • ve studiích sekundární struktury RNA, RNA-proteinových interakcí a RNA sestřihu.

Konsensus sekvence promotoru:

T3 AATTAACCCTCACTAAAGGGAGA
Podtržená pozice (+1) představuje první nukleotid inkorporovaný do RNA během transkripce. Pouze báze v této pozici a až do +3 jsou kritické pro transkripci a musí to být G respektive purinová báze.


T7 RNA polymeráza

Thermo Scientific bakteriofágní T7 RNA polymeráza je DNA - dependentní RNA polymeráza s vysokou specifitou pro svůj dvouřetězcový promotor. Enzym katalyzuje 5' → 3' syntézu RNA buď na jednovláknové, nebo dvouvláknové DNA ve směru syntézy od svého promotoru.

Přednosti

  • Inkorporuje modifikované nukleotidy (například aminoallyl-, biotin-, fluorescein-, digoxigenin- značené nukleotidy)

Aplikace

  • Syntéza neznačené a značené RNA, která může být použita:
    • pro hybridizaci, in vitro RNA translaci;
    • jako aRNA, siRNA, substrát při ochraně před RNázami, templát při sekvenování genomové DNA;
    • ve studiích sekundární struktury RNA, RNA-proteinových interakcí a RNA sestřihu.

Konsensus sekvence promotoru:

T7 TAATACGACTCACTATAGGGAGA
Podtržená pozice (+1) představuje první nukleotid inkorporovaný do RNA během transkripce. Pouze báze v této pozici a až do +3 jsou kritické pro transkripci a musí to být G respektive purinová báze.


DNáza I

Thermo Scientific DNáza I (bez RNáz) je endonukleáza štěpící jednořetězcovou nebo dvouřetězcovou DNA. Enzym hydrolyzuje fosfodiesterové vazby za vzniku mono - a oligodeoxyribonukleotidů s 5' – fosfátovou a 3' - OH skupinovou.

Enzymová aktivita je striktně závislá na Ca2+ a je aktivována Mg2+ nebo Mn2+ ionty.

  • V přítomnosti Mg2+ štěpí DNáza I oba řetězce dsDNA a to nezávisle a náhodným způsobem.
  • V přítomnosti Mn2+  enzym štěpí oba řetězce DNA na přibližně stejném místě za vzniku DNA fragmentů s tupými konci nebo s přesahujícími konci o délce jednoho nebo dvou nukleotidů.

Přednosti

  • Rekombinantní enzym.
  • Purifikace z hostitele neživočišného původu s nízkou úrovní RNáz.

Aplikace

  • Příprava RNA bez DNA.
  • Odstranění templátové DNA po in vitro transkripci.
  • Příprava DNA bez RNA před RT-PCR a RT-qPCR.
  • Značení DNA metodou  nick - translace ve spojení s DNA polymerázou I.
  • Studie DNA - proteinových interakcí pomocí DNázy I, RNase - free footprinting.
  • Tvorba knihovny náhodně překrývajících se DNA insertů. Používá se reakční pufr obsahující Mn2+.

Poznámka:
DNáza I je citlivá na fyzikální denaturaci. Míchejte ji jemně převracením zkumavky. Nevortexujte.


Agaráza

Agaráza specificky štěpí polysacharidové jádro agarózy na neoagaro - oligosacharidy. Agaráza umožňuje jemnou a účinnou regeneraci DNA nebo RNA fragmentů z agarózy s nízkým bodem tání. Získané nukleové kyseliny mohou být přímo použity pro amplifikaci, klonování, sekvenování, atd.

Přednosti

  • Šetrné obnovení intaktní DNA a RNA.
  • Vysoký výtěžek regenerace, > 90 % výchozí DNA získané po extrakci.
  • Ideální pro dlouhé (> 30 kb) i krátké (< 100 bp) DNA fragmenty.
  • Aktivní v pufrech TAE a TBE.

Aplikace

  • Kvantitativní regenerace DNA nebo RNA z agarózového gelu s nízkým bodem tání (LM).

Poznámky:

  • Inkubujte při 42 °C.
  • Konvenční agarózy nejsou vhodné pro štěpení agarázou.
  • Aktivita agarázy v různých pufrů (ve srovnání s aktivitou v testovacím pufru 1x TBE):
    • 1x TBE (90 mM Tris - borát, 2 mM EDTA, pH 8,3) - 100 %
    • 1x TAE (40 mM Tris - acetát, 1 mM EDTA, pH 8,5) - 120 %
    • 1x TPE (90 mM Tris - fosfát, 2 mM EDTA, pH 7,7) - 120 %
    • 1x Bis - Tris (50 mM Bis - Tris - HCl, 1 mM EDTA, pH 6,5) - 150 %       

Pyrofosfatáza, anorganická z kvasinek

Thermo Scientific Pyrofosfatáza (anorganická z kvasinek) katalyzuje hydrolýzu anorganického pyrofosfátu na dva orthofosfáty. Enzym vyžaduje dvojmocné kationty kovů s Mg2+ a za těchto podmínek má nejvyšší aktivitu.

Přednosti

  • Aktivní v Thermo Scientific pufrech pro DNA polymerázy, RNA polymerázy a reverzní transkriptázy

Aplikace

  • Vysoké výtěžky při syntéze RNA pomocí in vitro transkripce.
  • DNA polymerační reakce: prevence akumulace pyrofosfátu.
  • Odstranění kontaminantů PPi v roztocích používaných pro SNP genotypizaci pomocí metod založených na detekci pyrofosfátu.

Poznámka:
Enzym může být zředěn v dodávaném skladovacím (ředícím) pufru. Použití tohoto enzymu v některých aplikacích může být chráněno patentem a může vyžadovat licenci.


T4 RNA Ligáza

Thermo Scientific T4 RNA Ligáza katalyzuje ATP - dependentní intra - a intermolekulární tvorbu fosfodiesterových vazeb mezi konci jednovláknové RNA a DNA a to spojením konců s 5' - fosfátem a 3' - hydroxylovou skupinou. Minimální substrát je nukleosid 3', 5' - bifosfát při intermolekulární reakci a oligonukleotid o délce 8 bazí při intramolekulární reakci.

Aplikace

  • 3'-koncové značení RNA s cytidin 3', 5'-bis [alfa-32P] fosfátem.
  • Připojení RNA k RNA .
  • Syntéza oligoribonukleotidů a oligodeoxyribonukleotidů .
  • Specifická modifikace tRNA .
  • Ligace oligodeoxyribonukleotidu k jednovláknové cDNA při 5'RACE (Rapid Amplification of cDNA Ends).
  • Místně specifická syntéza kompozitních primerů pro PCR.

Poznámka:
Doporučená koncentrace BSA v reakční směsi je 0.1mg/ml.


RiboLock RNase Inhibitor

Thermo Scientific RiboLock RNase Inhibitor inhibuje aktivitu RNázy A, B a C a to vazbou na ně v nekompetitivním stavu v poměru 1:1. Inhibitor neblokuje eukaryotické RNázy T1, T2, U1, U2, CL3 a prokaryotické RNázy I a H.

Přednosti

  • Funguje v širokém rozmezí reakčních podmínek.
  • Chrání RNA před degradací při teplotách do 55 °C.

Poznámka:
DTT je dodáván ve skladovacím pufru, což zajišťuje jeho stabilitu během dlouhodobého skladování, ale není nutné pro aktivitu inhibitoru. Doporučená koncentrace je 1U /ul reakční směsi.

Potřebujete enzymy pro in vitro transkripci? Navštivte náš eshop, nebo vyplňte kontaktní formulář a specifikujte své požadavky

Položky označené hvězdičkou (*) jsou povinné.



Zasílání novinek e-mailem

Zadejte Váš e-mail a nechte si zasílat novinky a zajímavé informace do vaší e-mailové schránky.

Zasílání novinek e-mailem

Rychlý kontakt

BIOGEN PRAHA s.r.o.
Ke sv. Izidoru 2293/4A
140 00 PRAHA 4

Tel.: +420 241 401 693
E-mail:

>> Kontakty společnosti
>> Kontakty na biobary

© 2017, BIOGEN PRAHA s.r.o. – všechna práva vyhrazena

Prohlášení o přístupnosti | Podmínky užití | Ochrana osobních údajů | Mapa stránek

Webové stránky vytvořila eBRÁNA s.r.o. | Vytvořeno na CMS WebArchitect | SEO a internetový marketing

Nahoru ↑