DNA/RNA modifikující enzymy

DNA/RNA modifikující enzymy najdete v nabídce našeho eshopu. Více k jednotlivým enzymům si přečtěte níže.

Enzymy modifikující DNA a RNA jsou používané ve všech metodách molekulární biologie. Tyto enzymy zahrnují DNA a RNA polymerázy, fosfatázy, kinázy, nukleázy a další modifikující enzymy. Vyberte si z nabídky a zjistěte výhody a možnosti aplikace jednotlivých enzymů:


Ligázy

Ligázy zajišťují rychlou a účinnou ligaci (spojení) DNA a RNA řetězců. Vyberte si z nabídky:

T4 DNA Ligase

Thermo Scientific T4 DNA Ligase zajišťuje spojení konců dvou vláken nukleových kyselin, a to vytvořením fosfodiesterové vazby mezi 5'- koncem s fosfátem a 3' – koncem s hydroxylovou skupinou na 3'-uhlíku deoxyribózy. Enzym opravuje jednovláknové zlomy ve dvouvláknové DNA, RNA nebo hybridech DNA / RNA. Dále spojuje DNA fragmenty s lepivými nebo tupými konci, ale nemá žádnou aktivitu na jednovláknových nukleových kyselinách.

T4 DNA Ligase vyžaduje ATP jako kofaktor.

Výhody

  • Aktivní v Themo Scientific pufrech pro restrikční enzymy, PCR, RT (po přidání ATP)
  • Ligace lepivých konců je dokončena do 10 minut při pokojové teplotě
  • Dodává se s roztokem PEG pro efektivní ligaci tupých konců

Aplikace

  • Klonování fragmentů DNA štěpených restrikčními enzymy
  • Klonování PCR produktů
  • Připojování dvouvláknový oligonukleotidových „spojek“ (linkers) a adapterů k DNA
  • Místně řízená mutageneze
  • Metoda polymorfismu délky amplifikovaných fragmentů (AFLP)
  • Detekce RNA zprostředkovaná ligázou
  • Opravy zlomů v duplexech DNA, RNA nebo hybridech DNA/RNA
  • Cirkularizace lineární DNA

Poznámky

  • Vazba T4 DNA ligázy k DNA může způsobit posun pruhů DNA v agarózovém gelu. Aby se tomu zabránilo, inkubujte vzorky DNA v  6X Loading Dye a SDS roztoku při 70°C po dobu 5 minut nebo 65°C po dobu 10 minut a zchlaďte je na ledě před nanesením na gel.
  • Objem ligační reakční směsi by neměl přesáhnout 10% objemu kompetentních buněk při transformaci.
  • Před elektrotransformací odstraňte T4 DNA ligázu z ligační směsi kolonovou chromatografií nebo extrakcí chloroformem. Extrahovaná DNA může být dále vysrážena etanolem.

T4 RNA Ligase

Thermo Scientific T4 RNA Ligase katalyzuje ATP-dependentní intra- a intermolekulární tvorbu fosfodiesterových vazeb mezi konci jednovláknové RNA a DNA a to spojením konců s 5'-fosfátem a 3'- hydroxylovou skupinou. Minimální substrát je nukleosid 3', 5'-bifosfát při intermolekulární reakci a oligonukleotid o délce 8 bazí při intramolekulární reakci.

Aplikace

  • 3'-koncové značení RNA s cytidin 3', 5'-bis [alfa-32P] fosfátem
  • Připojení RNA k RNA
  • Syntéza oligoribonukleotidů a oligodeoxyribonukleotidů
  • Specifická modifikace tRNA
  • Ligace oligodeoxyribonukleotidu k jednovláknové cDNA při 5'RACE (Rapid Amplification of cDNA Ends)
  • Místně specifická syntéza kompozitních primerů pro PCR

Poznámka
Doporučená koncentrace BSA v reakční směsi je 0.1mg/ml.


Inhibitory RNáz

Inhibitory RNáz jsou určeny pro ochranu RNA před degradací. Používají se při in vitro transkripci a translaci, syntéze cDNA, amplifikaci a skladování RNA. Vyberte si z nabídky:

RiboLock RNase Inhibitor

Thermo Scientific RiboLock RNase Inhibitor inhibuje aktivitu RNázy A, B a C a to vazbou na ně v nekompetitivním stavu v poměru 1:1. Inhibitor neblokuje eukaryotické RNázy T1, T2, U1, U2, CL3 a prokaryotické RNázy I a H.

Výhody

  • Funguje v širokém rozmezí reakčních podmínek,
  • Chrání RNA před degradací při teplotách do 55°C

Poznámka
DTT je dodáván ve skladovacím pufru, což zajišťuje jeho stabilitu během dlouhodobého skladování, ale není nutné pro aktivitu inhibitoru. Doporučená koncentrace je 1U /ul reakční směsi.


DNA polymerázy

Mezofilní a termofilní DNA polymerázy jsou vhodné pro různé polymerační reakce, tvorbu tupých konců DNA, amplifikaci a značení DNA atd. V nabídce najdete:

Bsm DNA Polymerase, Large Fragment

Thermo Scientific Bsm DNA Polymerase, Large Fragment (velký fragment), je část DNA polymerázy z Bacillus smithii, která katalyzuje 5'=> 3' syntézu DNApostrádá 5 '→ 3' a 3 '→ 5' exonukleázovou aktivitu. Bsm DNA Polymerase-Large Fragment má silnou aktivitu pro náhradu řetězce a je aktivní v širokém rozsahu teplot od 30°C do 63°C (optimální aktivita při teplotě 60°C). Jedná se o enzym s podobnou funkcí jako má Bst DNA Polymerase –Large Fragment a může tuto polymerázu nahradit ve většině aplikací.

Enzym není vhodný pro PCR.

Výhody

  • Termofilní DNA polymeráza se silnou aktivitou pro náhradu řetězce

Aplikace

  • Izotermická amplifikace DNA pomocí následujících metod:
    • Amplifikační metoda LAMP (Loop-mediated isothermal amplification)
    • Celogenomová amplifikace WGA (Whole genome amplification)
    • Amplifikační metoda RAM (Ramification amplification)
  • Značení DNA pomocí náhodných primerů
  • Značení dsDNA doplněním 5´ přesahujících konců

Poznámka
Použití tohoto enzymu v některých aplikacích může být chráněno patentem a může vyžadovat licenci.

DNA Polymerase I

Thermo Scientific DNA Polymerase I je templát-dependentní DNA polymeráza, která katalyzuje syntézu DNA ve směru 5 '→ 3'. Enzym má také 3 '→ 5' exonukleázovou (proofreading) aktivitu, 5 '→ 3' exonukleázovou aktivitu a aktivitu ribonukleázy H.

Výhody

  • Inkorporuje do DNA modifikované nukleotidy (např. biotin-, digoxigenin-, aminoallyl-nukleotiy, fluorescenčně značené nukleotidy)
  • Aktivní v řadě pufru např. v pufrech pro restrikční enzymy, PCR, RT

Aplikace

  • Značení DNA pomocí nick-translace ve spojení s DNázou
  • Syntéza druhého vlákna cDNA ve spojení s RNázou H

Klenowův fragment

Thermo Scientific Klenow Fragment je velký fragment DNA polymerázy I, který vykazuje 5'→ 3' polymerázovou aktivitu a 3 '→ 5' exonukleázovou (proofreading) aktivitu, ale postrádá 5 '→ 3' exonukleázovou aktivitu DNA polymerázy I.

Výhody

  • Inkorporuje do DNA modifikované nukleotidy (např. Cy3-, Cy5-, aminoallyl-, biotin-, digoxigenin-nukleotidy, fluorescenčně značené nukleotidy)
  • Aktivní v pufrech pro restrikční enzymy, PCR, RT, a v pufru pro T4 DNA ligázu

Aplikace

  • Vytvoření tupých konců u DNA, a to doplněním 5´ přesahujících konců
  • Značení DNA pomocí náhodných primerů
  • Značení dsDNA doplněním 5´ přesahujících konců
  • Sekvenování DNA metodou Sanger
  • Místně specifické mutageneze DNA se syntetickými oligonukleotidy
  • Syntéza druhého vlákna cDNA

Klenowův Fragment , exo -

Thermo Scientific Klenowův Fragment, exo -, je velký fragment DNA polymerázy I, který vykazuje 5 ' → 3 ' polymerázovou aktivitu, ale postrádá 3 ' → 5 ' a 5 ' → 3 ' exonukleázovou aktivitu DNA polymerázy I. 3 ' → 5' exonukleázová aktivita enzymu je eliminována mutací v aktivním místě pro tuto funkci.

Výhody

  • Chybí 3 ' → 5 ' exonukleázová aktivita
  • Inkorporuje do DNA modifikované nukleotidy (např. Cy3 , Cy5 - , fluorescein - , rhodamin-, aminoallyl - , biotin - značené nukleotidy)
  • Aktivní v pufrech pro restrikční enzymy, PCR, RT

Aplikace

  • Značení DNA pomocí náhodných primerů
  • Značení dsDNA doplněním 5´ přesahujících konců
  • Amplifikační metoda SDA (Strand displacement amplification)
  • Sekvenování DNA metodou Sanger

Poznámka
Klenowův Fragment, exo -  se nedoporučuje pro tvorbu tupých konců DNA před ligací, protože velmi často přidává jeden nebo více dalších nukleotidů na 3'-tupý konec DNA a provádí to bez templátu.

phi29 DNA Polymerase

Thermo Scientific phi29 DNA Polymerase je vysoce procesivní polymeráza (více než 70 kb), která vykazuje silnou aktivitu pro náhradu řetězce, což umožňuje vysoce efektivní izotermickou amplifikaci DNA. phi29 DNA Polymerase také disponuje 3 ' → 5' exonukleázovou (proofreading) aktivitou a působí přednostně na jednovláknové DNA nebo RNA. Při jejím použití jsou velmi doporučovány 3' - modifikované primery.

Výhody

  • Nejvyšší procesivita a aktivita pro náhradu řetězce mezi známými DNA polymerázami - více než 70kb dlouhé úseky DNA mohou být syntetizovány
  • Velmi přesná syntéza DNA
  • Extrémně vysoké výtěžky amplifikované DNA i z nepatrného množství templátu
  • Amplifikační produkty mohou být přímo použity v následných aplikacích (PCR, restrikční štěpení, SNP genotypizace, atd.)

Aplikace

  • Metoda RCA (Rolling circle amplification): syntéza periodických DNA nanotemplátů
  • Metoda MDA (Multiple displacement amplification)
  • Nezkreslená amplifikace celého genomu (WGA)
  • Amplifikace DNA pro detekci SNP a STR
  • Amplifikace DNA z jedné buňky
  • Patogenní organismy nebo metagenomy
  • Amplifikace DNA z krevních skvrn na filtračním papíru
  • Příprava templátu DNA pro sekvenování
  • Amplifikace DNA s proteinovým primerem
  • In situ genotypizace s „padlock“ sondami
  • Klonování založené na rekombinaci
  • Bezbuněčné klonování letální DNA
  • Amplifikace DNA s RNA primerem

Poznámka
Přidání pyrofosfatázy do reakční směsi s phi29 DNA polymerázou může zvýšit syntézu DNA.
Použití tohoto enzymu v některých aplikacích může být chráněno patentem a může vyžadovat licenci.

T4 DNA Polymerase

Thermo ScientificT4 DNA Polymerase je templát-dependentní DNA polymeráza, která katalyzuje syntézu 5'-3' z primeru na jednovláknové DNA. Enzym má 3'-5 'exonukleázovou aktivitu, ale postrádá 5'-3' exonukleázovou aktivitu.

Výhody

  • Silnější 3'-5 'exonukleázová aktivita na jednovláknové než dvouvláknové DNA a má vyšší aktivitu (více než 200krát) než DNA polymeráza I (E. Coli) a Klenowův fragment
  • Aktivní v pufrech pro restrikční enzymy, PCR, RT, a v pufru pro T4 DNA ligázu

Aplikace

  • Tvorba tupých konců DNA: doplnění 5'-přesahujících konců nebo odstranění 3'- přesahujících konců
  • Tvorba tupých konců u PCR produktů s 3'-dA přesahujícími konci
  • Syntéza značených DNA sond
  • Místně řízená specifická mutageneze s oligonukleotidy
  • Klonování PCR produktů nezávislé na ligaci

T7 DNA Polymerase

Thermo Scientific T7 DNA Polymerase je templát-dependentní DNA polymeráza, která katalyzuje syntézu DNA ve směru 5 ' = > 3´. Jedná se o vysoce procesivní DNA polymerázu, a proto umožňuje kontinuální syntézu dlouhých úseků DNA. Enzym také vykazuje vysokou 3'= > 5' exonukleázovou aktivitu na jedno- i dvouvláknové DNA.

Výhody

  • Silná 3 ' = > 5 ' exonukleázová aktivita, přibližně 1000krát větší než má Klenowův fragment
  • Aktivní v pufrech pro restrikční enzymy

Aplikace

  • Izolace kovalentně uzavřené cirkulární DNA odstraněním zbytkové genomové DNA
  • Reakce prodlužování primerů na dlouhých templátech
  • Značení 3' – konce DNA
  • Prodlužování řetězce při místně řízené mutagenezi
  • Tvorba tupých konců doplněním 5'-přesahujících konců
  • Syntéza druhého řetězce cDNA
  • In situ detekce fragmentované DNA asociované s apoptózou

Poznámka
U aplikací prováděných při teplotě 37 °C enzym vyžaduje pouze krátkou dobu inkubace.

Terminal Deoxynucleotidyl Transferase

Thermo Scientific Terminal Deoxynucleotidyl Transferase (TdT) je templát- independentní DNA polymeráza, která katalyzuje opakované přidávání deoxyribonukleotidů na 3' - OH konec oligodeoxyribonukleotidů, jednořetězcové a dvouřetězcové DNA. TdT vyžaduje oligonukleotid alespoň o délce tří nukleotidů, který bude sloužit jako primer. Pokud je templátem RNA, TdT vykazuje různé fungování závislé na terciární struktuře 3'-konce akceptorové RNA a na typu nukleotidu. Obecně je aktivita enzymu nižší u RNA než když jako templát slouží DNA.

Výhody

  • Inkorporuje modifikované nukleotidy (např. fluorescein- , biotin- , aminoallyl- značené nukleotidy)

Aplikace

  • Výroba syntetických homo - a heteropolymerů
  • Tvorba homopolymerních konců u lineární dvouřetězcové DNA s jakýmkoliv typem 3' - OH konce
  • Značení oligodeoxyribonukleotidů a DNA
  • 5' - RACE ( Rapid Amplification of cDNA Ends )
  • In situ lokalizace apoptózy

Poznámka
Díky přítomnosti CoCl2 je TdT reakční pufr inkompatibilní s následnými aplikacemi. Proto je nutné odstranit CoCl2 z reakční směsi kolonovou chromatografií nebo fenol/chloroform extrakcí a následně provést srážení etanolem.

Terminal Transferase

Přesahující, ustupující nebo tupé konce dvou nebo jednořetězcové DNA slouží jako templát pro Terminal Transferase (TdT). Thermo Scientific TdT se izoluje z kmene E. Coli, který obsahuje klonovaný gen pro terminální transferázu z telecího brzlíku.

Výhody

  • Klonována a vyráběna v E. Coli
  • Vynikající stabilita a čistota ve srovnání s nativní TdT
  • Ekonomické

Aplikace

  • Přidání homopolymerních konců k plasmidové DNA a cDNA
  • 3' -koncové značení dvou- nebo jednořetězcové DNA s radioaktivně značenými nebo neradioaktivně značenými nukleotidy
  • Přidávání jednotlivých nukleotidů na 3 ' konec DNA při in vitro mutagenezi
  • Výroba syntetických homo - a heteropolymerů
  • RACE (Rapid Amplification of cDNA Ends)
  • In situ lokalizace apoptózy
  • Řešení komprese gelu a artefaktů pruhů při sekvenování DNA

Složení
TdT se dodává s optimalizovaným 10X pufrem (bez CoCl2) a zvlášť je 25 mM CoCl2. Chcete-li získat 1ml 1X testovacího pufru, smíchejte 100ul 10X pufru a 60ul 25mM CoCl2 s 840ul H2O. 1X TdT pufr obsahuje: 20 mM Tris -acetát pH 7,9 při 25 °C, 50mM octan draselný, doplněno se 1,5 mM CoCl2 .


Fosfatázy a kinázy

Alkalická fosfatáza a polynukleotid kináza pro DNA a RNA zajišťují defosforylaci nebo fosforylaci. Vyberte si z nabídky:

FastAP Thermosensitive Alkaline Phosphatase

Thermo Scientific FastAP Thermosensitive Alkaline Phosphatase katalyzuje uvolňování 5'- a 3' - fosfátové skupiny z DNA, RNA a nukleotidů. Tento enzym odstraňuje také fosfátové skupiny z proteinů. FastAP je nová alkalická fosfatáza, která je aktivní ve všech Thermo Scientific pufrech pro restrikční enzymy a pro PCR. Enzym defosforyluje všechny typy konců DNA (tupé, 5' - a 3'- přesahující konce) za 10 minut při teplotě 37°C. Enzym je inaktivován při teplotě 75°C po dobu 5 minut. Z tohoto důvodu nemusí být alkalická fosfatáza odstraněna před ligací.

Výhody

  • Rekombinantní enzym
  • Rychlá defosforylace - 10 minut při 37°C
  • Rychlá a kompletní inaktivace - 5 minut při teplotě 75°C
  • Současné štěpení a defosforylace vektorové DNA
  • 100% aktivní v pufrech pro restrikční enzymy a pro PCR
  • Jeden protokol pro všechny typy konců DNA: 5'- a 3'- přesahující konce, tupé konce, jednotlivé nukleotidy)
  • Čištění PCR produktů ve spojení s Exo I
  • Defosforylace proteinů

Aplikace

  • Defosforylace klonovacího DNA vektoru, aby se zabránilo recirkularizaci při ligaci
  • Současné štěpení a defosforylace vektorové DNA
  • Čištění PCR produktů: degradace nukleotidů před sekvenováním PCR produktů
  • Defosforylace nukleové kyseliny na 5' -konci před značením T4 polynukleotid-kinázou
  • Další aplikace kde je nutná defosforylace DNA a RNA substrátů
  • Defosforylace proteinů

Poznámky

  • Vazba FastAP termosenzitivní alkalické fosfatázy na DNA může vést k posunu pruhů v  agarózovém gelu. Aby se tomu zabránilo, inkubujte vzorky DNA v 6X Loading Dye a SDS roztoku při 65°C po dobu 10 minut a pak zchlaďte na ledu před elektroforézou.
  • FastAP termosenzitivní alkalická fosfatáza je aktivní ve všech pufrech pro restrikční enzymy a může být přidána přímo ke štěpené DNA. Tepelná inaktivace restrikčního enzymu před defosforylací není nutná.

T4 Polynucleotide Kinase

Thermo Scientific T4 Polynucleotide Kinase (T4 PNK) katalyzuje přenos gama - fosfátu z ATP na 5' - OH skupinu jedno a dvouřetězcové DNA nebo RNA, oligonukleotidy nebo nukleosid 3' - monofosfáty. Reakce je reverzibilní. V přítomnosti ADP T4 Polynucleotide Kinase vykazuje aktivitu 5' - fosfatázy a katalyzuje výměnu fosfátových skupin mezi 5' - P - oligo - polynukleotidem a ATP (výměnná reakce). Enzym má také aktivitu 3' - fosfatázy.

Výhody

  • Aktivní v Thermo Scientific pufrech pro restrikční enzymy, RT, a v pufru pro T4 DNA ligázu

Aplikace

  • Značení nukleových kyselin na 5' -konci, které mají být použity jako:
    • sondy pro hybridizaci
    • sondy pro mapování transkriptů
    • markery pro gelovou elektroforézu
    • primery pro sekvenování DNA
    • primery pro PCR
  • 5' - fosforylace oligonukleotidů, PCR produktů, DNA nebo RNA před ligací
  • Fosforylace PCR primerů
  • Detekce modifikace DNA u metody [32P] - postlabeling
  • Odstranění 3' - fosfátové skupiny

Poznámky
Polyethylenglykol (PEG) a spermicid zvyšují rychlost a účinnost fosforylační reakce. PEG se používá při výměnné reakci. Pokud je T4 polynukleotid-kináza inhibována amonnými ionty, použijte octan sodný pro vysrážení DNA před fosforylaci.


RNA polymerázy

RNA polymerázy se používají pro in vitro transkripci, značení RNA, syntézu antisense RNA a siRNA, studium sestřihu a sekundární struktury RNA. Vyberte si z nabídky:

Bacteriophage SP6 RNA polymerase

Thermo Scientific Bacteriophage SP6 RNA polymerase je DNA-dependentní RNA polymeráza s vysokou specifitou pro svůj dvouřetězcový promotor. Enzym katalyzuje 5 '→ 3' syntézu RNA buď na jednovláknové, nebo dvouvláknové DNA ve směru syntézy od svého promotoru a je schopen zařadit do RNA modifikované nukleotidy.

Výhody

  • Inkorporuje modifikované nukleotidy (např. aminoallyl-, biotin-, fluorescein-, digoxigenin- značené nukleotidy)

Aplikace

  • Syntéza neznačené a značené RNA, která může být použita:
    • Pro hybridizaci, in vitro RNA translaci
    • Jako aRNA, siRNA, substrát při ochraně před RNázami, templát při sekvenování genomové DNA
    • Ve studiích sekundární struktury RNA, RNA-proteinových interakcí a RNA sestřihu

T3 RNA polymerase

Thermo Scientific Bacteriophage T3 RNA polymerase je DNA-dependentní RNA polymeráza s vysokou specifitou pro svůj dvouřetězcový promotor. Enzym katalyzuje 5 '=> 3' syntézu RNA buď na jednovláknové, nebo dvouvláknové DNA ve směru syntézy od svého promotoru.

Výhody

  • Inkorporuje modifikované nukleotidy (např. aminoallyl-, biotin-, fluorescein-, digoxigenin- značené nukleotidy)

Aplikace

  • Syntéza neznačené a značené RNA, která může být použita:
    • Pro hybridizaci, in vitro RNA translaci
    • Jako aRNA, siRNA, substrát při ochraně před RNázami, templát při sekvenování genomové DNA
    • Ve studiích sekundární struktury RNA, RNA-proteinových interakcí a RNA sestřihu

T7 RNA polymerase

Thermo Scientific Bacteriophage T7 RNA polymerase je DNA-dependentní RNA polymeráza s vysokou specifitou pro svůj dvouřetězcový promotor. Enzym katalyzuje 5 '→ 3' syntézu RNA buď na jednovláknové, nebo dvouvláknové DNA ve směru syntézy od svého promotoru.

Výhody

  • Inkorporuje modifikované nukleotidy (např. aminoallyl-, biotin-, fluorescein-, digoxigenin- značené nukleotidy)

Aplikace

  • Syntéza neznačené a značené RNA, která může být použita:
    • Pro hybridizaci, in vitro RNA translaci
    • Jako aRNA, siRNA, substrát při ochraně před RNázami, templát při sekvenování genomové DNA
    • Ve studiích sekundární struktury RNA, RNA-proteinových interakcí a RNA sestřihu

Poznámky
Konsensus sekvence promotorů:
T3 AATTAACCCTCACTAAAGGGAGA
T7 TAATACGACTCACTATAGGGAGA
SP6 ATTTAGGTGACACTATAGAAGNG

Podtržená pozice (+1) představuje první nukleotid inkorporovaný do RNA během transkripce. Pouze báze v této pozici a až do +3 jsou kritické pro transkripci a musí to být G respektive purinová báze.


Nukleázy

Nukleázy představují velkou skupinu různých enzymů, které jsou používány v mnoha aplikacích molekulární biologie. Vyberte si z nabídky:

DNase I

Thermo Scientific DNase I (bez RNáz) je endonukleáza štěpící jednořetězcovou nebo dvouřetězcovou DNA. Enzym hydrolyzuje fosfodiesterové vazby za vzniku mono - a oligodeoxyribonukleotidů s 5' – fosfátovou a 3' - OH skupinovou. Enzymová aktivita je striktně závislá na Ca2+ a je aktivována Mg2+ nebo Mn2+ ionty.

  • V přítomnosti Mg2+ štěpí DNase I oba řetězce dsDNA a to nezávisle a náhodným způsobem.
  • V přítomnosti Mn2+ enzym štěpí oba řetězce DNA na přibližně stejném místě za vzniku DNA fragmentů s tupými konci nebo s přesahujícími konci o délce jednoho nebo dvou nukleotidů.

Výhody

  • Rekombinantní enzym
  • Purifikace z hostitele neživočišného původu s nízkou úrovní RNáz

Aplikace

  • Příprava RNA bez DNA
  • Odstranění templátové DNA po in vitro transkripci
  • Příprava DNA bez RNA před RT-PCR a RT-qPCR
  • Značení DNA metodou nick - translace ve spojení s DNA polymerázou I
  • Studie DNA - proteinových interakcí pomocí DNázy I, RNase - free footprinting

  • Tvorba knihovny náhodně překrývajících se DNA insertů. Používá se reakční pufr obsahující Mn2+.

Poznámka
DNase I je citlivá na fyzikální denaturaci. Míchejte ji jemně převracením zkumavky. Nevortexujte.

dsDNase

Thermo Scientific dsDNase je DNáza purifikovaná z krevet optimalizovaná pro rychlé a bezpečné odstranění kontaminující genomové DNA ze vzorků RNA. Enzym je endonukleáza, která štěpí fosfodiesterové vazby na DNA, čímž vznikají oligonukleotidy s 5' - fosfátovou a 3' – hydroxylovou skupinou. Vysoce specifická aktivita enzymu pro dvouřetězcovou DNA zajišťuje, že se neštěpí jednořetězcová RNA a DNA jako je cDNA a primery. dsDNase se snadno inaktivuje mírným zvýšením teploty (55°C). Tyto vlastnosti dělají z dsDNase vynikající volbu pro odstranění gDNA z předchozí reverzní transkripce. Toto výrazně zjednodušuje metodický postup, neboť se kombinuje odstranění genomové DNA a syntéza cDNA v jedné zkumavce.

Výhody

  • Vysoce specifická degradace dvouvláknové DNA
  • Rychlý 2 minutový protokol pro odstranění gDNA z předchozí reverzní transkripce
  • Tepelně labilní - nevratně se inaktivuje mírným zvýšením teploty (55°C)

Aplikace

  • Odstranění genomové DNA ze vzorků RNA z předchozí syntézy prvního vlákna cDNA, RT - PCR a RT-qPCR

Endonuclease IV

Thermo Scientific Endonuclease IV (Endo IV) rozeznává apurinová /apyrimidinová (AP) místa na dsDNA a štěpí fosfodiesterovou vazbu za vzniku hydroxylové skupiny na 3' -konci. Enzym může také působit jako 3' - diesteráza, která je schopna uvolnit 3' - fosfoglykolát nebo 3' -fosfát z poškozených konců dsDNA. Endo IV má také 3 ' = > 5' exonukleázovou aktivitu. Její fungování na substrátech je citlivé na iontovou sílu, kovové ionty, EDTA, a redukční podmínky. Substráty s 3' – ustupujícími konci jsou preferovaný substráty pro 3' = > 5' exonukleázovou aktivitu. Enzym nevyžaduje Mg2+ a je plně aktivní v přítomnosti EDTA v nízkých koncentracích.

Aplikace

  • Studium poškození DNA a reparace
  • Jednobuněčná gelová elektroforéza neboli kometový test
  • Výzkum protinádorových léků
  • Strukturní studie DNA
  • Analýza SNP

Endonuclease V

Thermo Scientific Endonuclease V T. maritima (Endo V) je 3'- endonukleáza podílející se na reparaci DNA a iniciuje odstranění deaminovaných bází z poškozené DNA včetně uracilu, hypoxanthinu a xanthinu. Endonuclease V je aktivní také na místech DNA bez báze a s močovinou, v místech nesprávného párování, místech s pseudo Y strukturou a s malou inzercí /delecí. Endonuclease V štěpí druhou fosfodiesterovou vazbu 3 ' před poškozením.

Výhody

  • Optimální aktivita při teplotách 65 až 70°C

Aplikace

  • Vysoko-kapacitní metody pro výzkum mutací
  • Studium mutageneze a reparace DNA
  • Štěpení v místě nesprávného párování
  • Stanovení genotypu

Poznámky
Použití tohoto enzymu v některých aplikacích může být chráněno patentem a může vyžadovat licenci.
Když je enzym v přebytku, dochází u řetězců s primárními zlomy ke vzniku sekundárních zlomů na komplementárním řetězci, což vede k dvouvláknovému zlomu. Při nízkých koncentracích Endonuclease V nejdříve štěpí DNA v místech poškození nacházejících se blíže k 5' - konci molekuly DNA. Jednořetězcová DNA je štěpena s mnohem nižší účinností. Mg2+ nebo Mn2 + ionty jsou nezbytné pro aktivitu enzymu .

Exonuclease I

Thermo Scientific Exonuclease I (ExoI) štěpí jednořetězcovou DNA ve směru 3 '=> 5'. Enzym postupně uvolňuje deoxyribonukleosid 5'-monofosfáty a nechává intaktní 5'-koncové dinukleotidy.
Enzym neštěpí DNA řetězce s terminální 3'-OH skupinou blokovanou fosforylovou nebo acetylovou skupinou.

Výhody

  • Aktivní v pufrech pro PCR

Aplikace

  • Odstranění primerů z PCR reakčních směsí:
    • před sekvenováním PCR produktů
    • pro metodu „one-tube megaprimer PCR mutagenesis“
    • Odstranění jednovláknové DNA obsahující 3'-hydroxylový konec ze směsi nukleových kyselin
    • Test na přítomnost jednořetězcové DNA s 3'-hydroxylovým koncem

Poznámka
Enzym není vhodný pro odstraňování 3'-přesahujících konců u dsDNA.

Exonuclease III

Thermo Scientific Exonuclease III (ExoIII) vykazuje čtyři katalytické aktivity. 3 ' = > 5' exodeoxyribonukleázová aktivita je specifická pro dvouvláknovou DNA. ExoIII degraduje dsDNA od tupých konců, 5' – přesahujících konců nebo zlomůuvolňuje 5'- mononukleotidy z 3' - konce DNA a vytváří úseky jednořetězcové DNA. Enzym není aktivní na 3' - přesahujících koncích DNA, které nejsou dlouhé alespoň čtyři báze a nenesou 3' - terminální C - zbytek, na jednořetězcové DNA nebo na nukleotidech spojených fosfortiolátem.

ExoIII má aktivitu 3' – fosfatázy, která odstraňuje 3' -terminální fosfát a vytváří 3' - OH skupinu. ExoIII má aktivitu RNázy H a exonukleolyticky degraduje vlákno RNA v hybridech RNA / DNA. Aktivitou ExpOOO apurinové / apyrimidinové - endonukleázy štěpí fosfodiesterové vazby na apurinových nebo apyrimidinových místech za vzniku 5' - konců, které jsou bez báze.

Výhody

  • Aktivní v pufrech pro restrikční enzymy

Aplikace

  • Tvorba delecí v DNA fragmentech ve spojení s S1 nukleázou
  • Syntéza jednovláknového templátu pro dideoxy- sekvenování DNA
  • Místně řízená mutageneze
  • Klonování PCR produktů
  • Příprava specifických sond pro řetězce

Poznámka
Míra štěpení DNA pomocí ExoIII závisí na teplotě, koncentraci solí, a molárním poměru DNA a enzymu v reakční směsi. Optimální reakční podmínky by měly být stanoveny experimentálně .

Lambda Exonuclease

Thermo Scientific Lambda Exonuclease je velmi procesivní 5 '=> 3' exodeoxyribonukleáza. Enzym selektivně štěpí 5'-fosforylováné vlákno dvouřetězcové DNA. Enzym vykazuje nízkou aktivitu na jednovláknové DNA a nefosforylované DNA, nemá žádnou aktivitu na zlomech a omezenou aktivitu v mezerách DNA.

Výhody

  • Aktivní v Thermo Scientific pufrech pro PCR

Aplikace

  • Syntéza jednořetězcových PCR produktů pro použití při:
    • sekvenování DNA
    • analýze SSCP (Single-strand conformation polymorphism) u DNA
    • amplifikační metodě RCA (Rolling circle amplification)
    • Výroba jednovláknové DNA z dvouvláknových DNA fragmentů
    • Klonování PCR produktů

Poznámka
Použití tohoto enzymu v některých aplikacích může být chráněno patentem a může vyžadovat licenci.

S7 Nuclease

Thermo Scientific Micrococcal Nuclease (S7 Nuclease) je relativně nespecifická endo-exonukleáza, která štěpí jednořetězcové a dvouřetězcové nukleové kyseliny, ale je více aktivní na jednovláknových substrátech. Štěpení DNA nebo RNA dochází přednostně v AT nebo AU-bohatých úsecích za vzniku mononukleotidů a oligonukleotidů s koncovým 3'-fosfátem. Aktivita enzymu je striktně závislá na Ca2+.

Aplikace

  • Hydrolýza nukleových kyselin v buněčných extraktech
  • Sekvenování RNA
  • Studie struktury chromatinu
  • Modely pro skládání proteinů a pro strukturně-funkční studie

RNase A

Thermo Scientific RNase A (bez DNáz a proteáz) je endoribonukleáza, která specificky degraduje jednovláknovou RNA na C a U zbytcích. Enzym štěpí fosfodiesterovou vazbu mezi 5' - ribózou jednoho nukleotidu a fosfátovou skupinou připojené k 3' - ribóze sousedního pyrimidinového nukleotidu. Výsledný 2', 3' - cyklický fosfát se hydrolyzuje na 3' - nukleosid fosfát.

Výhody

  • RNase A je bez DNázové aktivity. Nemusí se zahřívat před použitím.

Aplikace

  • Příprava plasmidové a genomové DNA
  • Odstranění RNA z rekombinantních proteinových přípravků
  • Test ochrany před ribonukleázami. Používá se ve spojení s RNase T1.
  • Mapování jednonukleotidových mutací v DNA nebo RNA

Poznámky
Doporučená koncentrace RNase A je 1 až 100 ug / ml v závislosti na aplikaci. Enzym je aktivní v širokém rozmezí reakčních podmínek. Při nízkých koncentracích solí (0 až 100 mM NaCl) RNase A štěpí jednořetězcovou a dvouřetězcovou RNA a také RNA vlákno v hybridech RNA/ DNA. Nicméně při koncentraci NaCl 0,3 M  (nebo vyšší) RNase A specificky štěpí jednořetězcovou RNA.

RNase A/T1 Mix

Thermo Scientific RNase A/T1 Mix kombinuje RNA degradační aktivitu obou RNáz neboli RNase A a RNase T1. Mix specificky hydrolyzuje RNA na C a U zbytcích - RNase T1 konkrétně hydrolyzuje RNA na G zbytcích.

Výhody

  • Vyšší úroveň degradace RNA než při použití jednotlivých RNáz samostatně
  • Bez DNázové aktivity - není nutné zahřívat mix před použitím

Aplikace

  • Odstranění RNA z DNA vzorků
  • Odstranění RNA z rekombinantních proteinů
  • Test ochrany před ribonukleázami

Ribonuclease H

Thermo Scientific Ribonuclease H (RNase H) specificky degraduje vlákno RNA v hybridech RNA/DNA. Enzym nehydrolyzuje fosfodiesterové vazby v jednovláknové a dvouvláknové DNA a RNA.

Aplikace

  • Odstranění mRNA před syntézou druhého řetězce cDNA
  • RT-PCR a qRT-PCR: odstranění RNA po syntéze prvního řetězce cDNA
  • Odstranění poly (A) sekvence mRNA po hybridizaci s oligo (dT)
  • Místně specifické štěpení RNA
  • Studie in vitro reakčních produktů polyadenylace

Ribonuclease I

Thermo Scientific Ribonuclease I (RNase I) je endoribonukleáza, která přednostně hydrolyzuje jednovláknovou RNA na nukleosidy 3'- monofosfáty za vzniku meziproduktu nukleosid 2´, 3' - cyklického monofosfátu.

Enzym není vhodný pro PCR.

Výhody

  • Stabilní a aktivní za nejrůznějších reakčních podmínek
  • Může být inaktivována tepelně - 30 minut při teplotě 100°C

Aplikace

  • Odstranění RNA z DNA roztoků
  • Odstranění RNA z rekombinantních proteinů
  • Test ochrany před nukleázami

Poznámky
Savčí inhibitory ribonukleáz nemají žádný vliv na RNase I. RNase I se váže na DNA, ale nedegraduje ji. Aminokyselinová sekvence RNase I je typická pro rodinu RNase T2. Bez iontové detergenty (např. Triton X - 100) neinhibují RNase I a mohou dokonce mírně stimulovat její aktivitu a stabilitu proti tepelné inaktivaci. Triton X - 100 nebo BSA (0,1 mg / ml) mohou zabránit adhezi RNase I ke stěnám skleněných nádob při práci se zředěnými roztoky. Polyaminy stimulují aktivitu RNase I.

RNase T1

Thermo Scientific RNase T1 je endoribonukleáza, která specificky degraduje jednovláknovou RNA u G zbytků. Enzym štěpí fosfodiesterovou vazbu mezi 3'-guaninovým zbytkem a 5'-OH zbytkem sousedících nukleotidů za vzniku meziproduktu 2´, 3'-cyklického fosfátu. Produkty reakce jsou 3'-GMP a oligonukleotidy s terminální 3'-GMP.

RNase T1 nevyžaduje kovové ionty pro aktivitu.

Aplikace

  • Odstranění RNA z DNA vzorků
  • Sekvenování RNA
  • Test ochrany před ribonukleázami. Používá se ve spojení s RNase A
  • Odstranění RNA z rekombinantních proteinů
  • Stanovení úrovně transkriptů RNA syntetizované in vitro podle templátu DNA obsahující "G-less cassette"

S1 Nuclease

Thermo Scientific S1 Nuclease degraduje jednovláknové nukleové kyseliny za vzniku 5'-fosforylovaných mono- nebo oligonukleotidů. Enzym je pětkrát více aktivní na DNA než na RNA. S1 Nuclease také štěpí dsDNA v jednovláknových oblastech vzniklých díky zlomům, mezerám, nesprávnému párováním bazí nebo vlásence. S1 Nuclease vykazuje 3'-fosfomonoesterázovou aktivitu.
Enzym je glykoprotein s 18% obsahem sacharidů.

Aplikace

  • Odstranění jednovláknových přesahujících konců u DNA fragmentů
  • S1 mapování transkriptů
  • Štěpení vlásenek
  • Tvorba delecí v DNA fragmentech ve spojení s Exonuclease III

Poznámka
S1 Nuclease umí zavádět zlomy do dvouřetězcové DNA, RNA a hybridů DNA/RNA při vysoké koncentraci enzymu a nízké koncentraci solí.


Další modifikující enzymy

Agarase

Agaráza specificky štěpí polysacharidové jádro agarózy na neoagaro - oligosacharidy. Agaráza umožňuje jemnou a účinnou regeneraci DNA nebo RNA fragmentů z agarózy s nízkým bodem tání. Získané nukleové kyseliny mohou být přímo použity pro amplifikaci, klonování, sekvenování, atd.

Výhody

  • Šetrné obnovení intaktní DNA a RNA
  • Vysoký výtěžek regenerace, > 90 % výchozí DNA získané po extrakci
  • Ideální pro dlouhé (> 30 kb) i krátké (< 100 bp) DNA fragmenty
  • Aktivní v pufrech TAE a TBE

Aplikace

  • Kvantitativní regenerace DNA nebo RNA z agarózového gelu s nízkým bodem tání (LM)

Poznámky

  • Inkubujte při 42°C
  • Konvenční agarózy nejsou vhodné pro štěpení agarázou
  • Aktivita agarázy v různých pufrů (ve srovnání s aktivitou v testovacím pufru 1x TBE):
  • 1x TBE (90 mM Tris - borát, 2 mM EDTA, pH 8,3) - 100 %
  • 1x TAE (40 mM Tris - acetát, 1 mM EDTA, pH 8,5) - 120 %
  • 1x TPE (90 mM Tris - fosfát, 2 mM EDTA, pH 7,7) - 120 %
  • 1x Bis - Tris (50 mM Bis - Tris - HCl, 1 mM EDTA, pH 6,5) - 150 %

Proteinase K

Thermo Scientific Proteinase K je endolytická proteáza, která štěpí peptidové vazby na karboxylové straně alifatických, aromatických nebo hydrofobních aminokyselin. Proteinase K je klasifikována jako serinová proteáza. Nejmenší peptid, který může být hydrolyzován tímto enzymem je tetrapeptid.

Výhody

  • V roztoku pro přímé použití
  • Aktivní v širokém rozmezí reakčních podmínek

Aplikace

  • Izolace genomové DNA z myšího ocasu
  • Izolace genomové DNA z kultivovaných buněk
  • Odstranění DNáz a RNáz při izolaci DNA a RNA z tkání nebo buněčných linií
  • Stanovení lokalizace enzymu
  • Zlepšení účinnosti při klonování PCR produktů

Poznámky

  • Doporučená pracovní koncentrace Proteinase K je 0,05 až 1 mg/ml. Aktivita enzymu je stimulována 0,2-1 % SDS nebo 1-4 M močovinou.
  • Ca2+ chrání Proteinase K před autolýzou, zvyšují tepelnou stabilitu a mají regulační funkci pro vazebná místa substrátu Proteinase K
  • Stabilní v širokém rozmezí pH : 4,0 - 12,5, optimální pH 7,5 až 8,0
  • Optimální aktivita při 50 až 55°C
  • Rychlá denaturace enzymu při teplotách nad 65°C

Pyrophosphatase, Inorganic

Thermo Scientific Pyrophosphatase (anorganická z kvasinek) katalyzuje hydrolýzu anorganického pyrofosfátu na dva orthofosfáty. Enzym vyžaduje dvojmocné kationty kovů s Mg2+ a za těchto podmínek má nejvyšší aktivitu.

Výhody

  • Aktivní v Thermo Scientific pufrech pro DNA polymerázy, RNA polymerázy a reverzní transkriptázy

Aplikace

  • Vysoké výtěžky při syntéze RNA pomocí in vitro transkripce
  • DNA polymerační reakce: prevence akumulace pyrofosfátu
  • Odstranění kontaminantů PPi v roztocích používaných pro SNP genotypizaci pomocí metod založených na detekci pyrofosfátu

Poznámka
Enzym může být zředěn v dodávaném skladovacím (ředícím) pufru. Použití tohoto enzymu v některých aplikacích může být chráněno patentem a může vyžadovat licenci.


Seznam všech modifikovaných enzýmů

Informujte se podrobněji z produktových listů Fermentas

Enzyme Amount per assay Incubation temp., °C Incubation time, hour QC performed
Ligases
T4 DNA Ligase 200 u 37 4 dsEndo, LO, B/W, RNase
T4 RNA Ligase 50 u 37 4 dsEndo, LO, RNase
Phosphatases and Kinase
FastAP™ Thermosensitive Alkaline Phosphatase 10 u 37 4 dsEndo, Exo I, RNase
Shrimp Alkaline Phosphatase (SAP) 10 u 37 1 dsEndo, Exo I, B/W, RNase
T4 Polynucleotide Kinase (T4 PNK) 50 u 37 4 dsEndo, Exo I, RNase
Thermophilic DNA Polymerases
DreamTaq™ DNA Polymerase 10 u 37 4 dsEndo, Exo II, RNase
DreamTaq™ Green DNA Polymerase - novinka
Bsm DNA Polymerase, Large Fragment - novinka
Maxima® Hot Start Taq DNA Polymerase 10 u
10 u
37, 65
37
4
4
Exo I
dsEndo, RNase
TrueStart™ Hot Start Taq DNA Polymerase 10 u
10 u
37, 70
37
4
4
Exo II, dsEndo
RNase
Taq DNA Polymerase (recombinant) 10 u 37, 70 4 dsEndo, Exo II, RNase
Taq DNA Polymerase
(native, without BSA)
(native, with BSA)
10 u
10 u
70
70
4
4
dsEndo, Exo II, RNase
Pfu DNA Polymerase (native) 10 u 72 4 dsEndo, Exo II
Pfu DNA Polymerase (recombinant) 10 u 37, 72 4 dsEndo, Exo II
Mesophilic DNA Polymerases
phi29 DNA Polymerase 100 u 30 4 ds-, ssEndo
DNA Polymerase I, E.coli 20 u 37 4 dsEndo
Klenow Fragment 20 u 37 4 dsEndo
Klenow Fragment, exo- 20 u 37 4 dsEndo, Exo I, LO
T4 DNA Polymerase 10 u 37 4 ds-, ssEndo
T7 DNA Polymerase 10 u 37 4 dsEndo
Terminal Deoxynucleotidyl Transferase (TdT) 60 u 37 4 dsEndo, LO, RNase
Reverse Transcriptases
RevertAid™ H Minus M-MuLV Reverse Transcriptase 2000 u 37 4 dsEndo, LO, RNase
RevertAid™ M-MuLV Reverse
Transcriptase
2000 u 37 4 dsEndo, LO, RNase
RevertAid™ Premium Reverse Transcriptase - novinka
RevertAid™ Reverse Transcriptase
M-MuLV Reverse Transcriptase 200 u 37 4 dsEndo, LO, RNase
AMV Reverse Transcriptase 25 u
40 u
37
37
16
4
dsEndo
Exo I, RNase
Maxima® Reverse Transcriptase - novinka
RNA Polymerases
T7 RNA Polymerase 200 u 37 1 dsEndo, Exo I, RNase
SP6 RNA Polymerase 200 u 37 1 dsEndo, Exo I, RNase
T3 RNA Polymerase 200 u 37 1 dsEndo, Exo I, RNase
RNase Inhibitor
RiboLock™ RNase Inhibitor 200 u 37 4 dsEndo, LO, RNase
Nucleases (DNases, RNases)
DNase I, RNase-free 10 u 37 4 RNase, Protease
Endonuclease IV, E.coli (Endo IV) 20 u 37 1 dsEndo, Exo I, RNase
Endonuclease V, T.maritima (Endo V) 25 u 37 4 dsEndo, Exo I, LO, RNase
Exonuclease I, E.coli (Exo I) 100 u 37 16 ds-, ssEndo, Exo II, RNase
Exonuclease III, E.coli (Exo III) 25 u 37 4 dsEndo
Lambda Exonuclease 100 u 37 4 dsEndo
RNase A, DNase and protease-free 5 µg
25 µg
37
37
18
18
dsEndo, LO
Protease
RNase T1 1000 u
10000 u
37
37
18
18
dsEndo, LO
Protease
RNase A/T1 Mix 2 µl
10 µl
37
37
18
18
dsEndo, LO
Protease
RNase I, E.coli 80 u 37 4 dsEndo, Exo I, LO
RNase H, E.coli 10 u 37 1 dsEndo, Exo I, RNase
S1 Nuclease
Other Enzymes
Agarase 5 u 37 4 dsEndo, LO, B/W, RNase
Proteinase K (recombinant), PCR grade 200 µg
40 µg
37
37
16
16
dsEndo, Exo I,
RNase
Pyrophosphatase, Inorganic (from yeast) 1 u 37 24 dsEndo, Exo I, LO, RNase
Uracil-DNA Glycosylase (UDG) 50 u 37 4 dsEndo, LO, RNase
Primers
Exo-Resistant Random Primer
M13/pUC Sequencing Primers
Oligo(dT)18 Primer
pJET1.2 Sequencing Primers
Random Hexamer Primer
Transcription Promoter Sequencing Primers

Máte zájem o DNA/RNA modifikující enzymy? Napište nám!

Položky označené hvězdičkou (*) jsou povinné.



Zasílání novinek e-mailem

Zadejte Váš e-mail a nechte si zasílat novinky a zajímavé informace do vaší e-mailové schránky.

Zasílání novinek e-mailem

Rychlý kontakt

BIOGEN PRAHA s.r.o.
Ke sv. Izidoru 2293/4A
140 00 PRAHA 4

Tel.: +420 241 401 693
E-mail:

>> Kontakty společnosti
>> Kontakty na biobary

© 2017, BIOGEN PRAHA s.r.o. – všechna práva vyhrazena

Prohlášení o přístupnosti | Podmínky užití | Ochrana osobních údajů | Mapa stránek

Webové stránky vytvořila eBRÁNA s.r.o. | Vytvořeno na CMS WebArchitect | SEO a internetový marketing

Nahoru ↑